From 321825828ac918bad28d0597a8616c6dc9802c3c Mon Sep 17 00:00:00 2001
From: Andinus <andinus@nand.sh>
Date: Wed, 11 Aug 2021 15:26:15 +0530
Subject: Add solved exercises

---
 raku/nucleotide-count/NucleotideCount.rakumod   |  6 ++
 raku/nucleotide-count/README.md                 | 36 ++++++++++
 raku/nucleotide-count/nucleotide-count.rakutest | 95 +++++++++++++++++++++++++
 3 files changed, 137 insertions(+)
 create mode 100644 raku/nucleotide-count/NucleotideCount.rakumod
 create mode 100644 raku/nucleotide-count/README.md
 create mode 100644 raku/nucleotide-count/nucleotide-count.rakutest

(limited to 'raku/nucleotide-count')

diff --git a/raku/nucleotide-count/NucleotideCount.rakumod b/raku/nucleotide-count/NucleotideCount.rakumod
new file mode 100644
index 0000000..03bae38
--- /dev/null
+++ b/raku/nucleotide-count/NucleotideCount.rakumod
@@ -0,0 +1,6 @@
+unit module NucleotideCount;
+
+subset DNA of Str where * !~~ /<-[ACGT]>/;
+sub nucleotide-count (DNA $strand) is export {
+    $strand.comb.Bag;
+}
diff --git a/raku/nucleotide-count/README.md b/raku/nucleotide-count/README.md
new file mode 100644
index 0000000..7ac2b56
--- /dev/null
+++ b/raku/nucleotide-count/README.md
@@ -0,0 +1,36 @@
+# Nucleotide Count
+
+Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+
+The genetic language of every living thing on the planet is DNA.
+DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+Here is an analogy:
+- twigs are to birds nests as
+- nucleotides are to DNA as
+- legos are to lego houses as
+- words are to sentences as...
+
+## Resources
+
+Remember to check out the Raku [documentation](https://docs.raku.org/) and
+[resources](https://raku.org/resources/) pages for information, tips, and
+examples if you get stuck.
+
+## Running the tests
+
+There is a test suite and module included with the exercise.
+The test suite (a file with the extension `.rakutest`) will attempt to run routines
+from the module (a file with the extension `.rakumod`).
+Add/modify routines in the module so that the tests will pass! You can view the
+test data by executing the command `raku --doc *.rakutest` (\* being the name of the
+test suite), and run the test suite for the exercise by executing the command
+`prove6 .` in the exercise directory.
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
diff --git a/raku/nucleotide-count/nucleotide-count.rakutest b/raku/nucleotide-count/nucleotide-count.rakutest
new file mode 100644
index 0000000..51e405a
--- /dev/null
+++ b/raku/nucleotide-count/nucleotide-count.rakutest
@@ -0,0 +1,95 @@
+#!/usr/bin/env raku
+use Test;
+use JSON::Fast;
+use lib $?FILE.IO.dirname;
+use NucleotideCount;
+plan 5;
+
+my @test-cases = from-json($=pod.pop.contents).List;
+for @test-cases -> %case {
+  given %case<expected> {
+    when .<error>.so {
+      throws-like
+        { nucleotide-count %case<input><strand> },
+        Exception,
+        message => /
+          $( %case<expected><error> )
+          || 'Constraint type check failed in binding to parameter'
+        /,
+        %case<description>;
+    }
+
+    default {
+      cmp-ok nucleotide-count(%case<input><strand>),
+        '~~', %case<expected>.Bag, %case<description>;
+    }
+  }
+}
+
+=head2 Test Cases
+=begin code
+[
+  {
+    "description": "count all nucleotides in a strand: empty strand",
+    "expected": {
+      "A": 0,
+      "C": 0,
+      "G": 0,
+      "T": 0
+    },
+    "input": {
+      "strand": ""
+    },
+    "property": "nucleotideCounts"
+  },
+  {
+    "description": "count all nucleotides in a strand: can count one nucleotide in single-character input",
+    "expected": {
+      "A": 0,
+      "C": 0,
+      "G": 1,
+      "T": 0
+    },
+    "input": {
+      "strand": "G"
+    },
+    "property": "nucleotideCounts"
+  },
+  {
+    "description": "count all nucleotides in a strand: strand with repeated nucleotide",
+    "expected": {
+      "A": 0,
+      "C": 0,
+      "G": 7,
+      "T": 0
+    },
+    "input": {
+      "strand": "GGGGGGG"
+    },
+    "property": "nucleotideCounts"
+  },
+  {
+    "description": "count all nucleotides in a strand: strand with multiple nucleotides",
+    "expected": {
+      "A": 20,
+      "C": 12,
+      "G": 17,
+      "T": 21
+    },
+    "input": {
+      "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+    },
+    "property": "nucleotideCounts"
+  },
+  {
+    "description": "count all nucleotides in a strand: strand with invalid nucleotides",
+    "expected": {
+      "error": "Invalid nucleotide in strand"
+    },
+    "input": {
+      "strand": "AGXXACT"
+    },
+    "property": "nucleotideCounts"
+  }
+]
+=end code
-- 
cgit 1.4.1-2-gfad0