1 files changed, 39 insertions, 0 deletions
diff --git a/go/nucleotide-count/cases_test.go b/go/nucleotide-count/cases_test.go
new file mode 100644
index 0000000..98d5cac
--- /dev/null
+++ b/go/nucleotide-count/cases_test.go
@@ -0,0 +1,39 @@
+package dna
+
+// Source: exercism/problem-specifications
+// Commit: 879a096 nucleotide-count: Apply new "input" policy
+// Problem Specifications Version: 1.3.0
+
+// count all nucleotides in a strand
+var testCases = []struct {
+	description   string
+	strand        string
+	expected      Histogram
+	errorExpected bool
+}{
+	{
+		description: "empty strand",
+		strand:      "",
+		expected:    Histogram{'A': 0, 'C': 0, 'G': 0, 'T': 0},
+	},
+	{
+		description: "can count one nucleotide in single-character input",
+		strand:      "G",
+		expected:    Histogram{'A': 0, 'C': 0, 'G': 1, 'T': 0},
+	},
+	{
+		description: "strand with repeated nucleotide",
+		strand:      "GGGGGGG",
+		expected:    Histogram{'A': 0, 'C': 0, 'G': 7, 'T': 0},
+	},
+	{
+		description: "strand with multiple nucleotides",
+		strand:      "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
+		expected:    Histogram{'A': 20, 'C': 12, 'G': 17, 'T': 21},
+	},
+	{
+		description:   "strand with invalid nucleotides",
+		strand:        "AGXXACT",
+		errorExpected: true,
+	},
+}